The phbF gene encoding a putative regulator was located downstream

from phbCB [29]. In this work we characterized the transcriptional regulator PhbF of Herbaspirillum seropedicae SmR1. Methods AZ 628 in vitro Strains and plasmids All bacterial strains and plasmids used in this work are listed in Table 1. Table 1 Strains and plasmids used in this work Strains Relevant genotype Reference/source E. coli     BL21(DE3) hsdS gal (λcIts 857 ind1 Sam7 nin5 lacUV5-T7 gene 1). Invitrogen ET8000 rbs lacZ::IS1 gyrA hutCc k (wild-type). [42] H. seropedicae     SmR1 Wild-type, Nif+, SmR. SBI-0206965 nmr [43] Plasmids     pET-28a Expression vector, T7 promoter, KmR. Novagen pDK6 Expression vector tac promoter lacIq, KmR. [44] pKADO3 H. seropedicae SmR1 phbF cloned into pET-28a; expresses the His-tag PhbF protein. This work pKADO5 353 bp containing phbF promoter Belnacasan datasheet region cloned into pMP220 resulting in the phbF:: lacZ transcriptional fusion. This work. pMMS31 Derivative of pDK6 encoding PhbF from H. seropedicae SmR1. This work. pMMS35 381 bp containing phaP1 promoter region cloned into pMP220 resulting in the phbP1:: lacZ transcriptional fusion. This work. pMP220 Vector used to construct transcriptional lacZ fusions; TcR. [32] Media and growth conditions Escherichia coli strains were grown in LB or M9 minimal media at 37°C [30]. The H. seropedicae SmR1 strain was grown at 30°C in NFbHPN-Malate

medium supplemented with 20 mM NH4Cl [31]. Antibiotics were added as follows: ampicillin 100 μg.mL-1, tetracycline 10 μg.mL-1, streptomycin 20 μg.mL-1 (E. coli) or 80 μg.mL-1 (H. seropedicae SmR1), kanamycin 50 μg.mL-1 oxyclozanide (E. coli) or 500 μg.mL-1 (H. seropedicae SmR1), chloramphenicol 30 μg.mL-1 (E. coli) or 150 μg.mL-1 (H. seropedicae SmR1) and nalidixic acid 10 μg.mL-1. Plasmid Construction The phbF gene was amplified from the H. seropedicae SmR1 genome using the primers 5′GACTGGACTTCATATGACTACTGC3′ and 5′CAACAGGATCCGGCAGAATG3′ carrying NdeI or HindIII restriction sites (underlined). The amplified product was cloned into pET-28a to yield plasmid pKADO3, which over-expresses the PhbF protein fused to an N-terminal six-histidine tag (His-PhbF). To

express PhbF from a tac promoter, phbF was obtained in an XbaI/HindIII fragment from pKADO3 and cloned into pDK6, yielding plasmid pMMS31. Construction of transcriptional fusions phbF::lacZ and phaP1::lacZ The promoter regions of phbF (containing 353 bp including 54 bp of the phbF coding sequence) and phaP1 (containing 381 bp including 28 bp of the phaP1 coding sequence) were amplified from the H. seropedicae SmR1 genome and cloned into pMP220 [32], upstream from the promoter-less lacZ gene to yield the respective plasmids pKADO5 and pMMS35. β-galactosidase activity assay β-galactosidase activity was determined in E. coli ET8000 carrying transcriptional fusion plasmids (pKADO5 or pMMS35), in the presence or absence of plasmid pMMS31 (expresses PhbF), grown in M9 minimal medium as described [33].