5 ml vial, The vials were incubated at 40°C for 30 minutes. Each vial was filled with the perfluoropropane gas (C3F8), then the vials were mechanically shaken for 45 seconds in a dental amalgamator (YJT, Shanghai Medical Instrument Co., Ltd.)

and quiescence for 5 min. This solution was diluted by phosphate-bufferedsaline, sterilized by Co60 and stored at 4°C;. Then the self-made lipid microbubbles were made. The average diameter was 1.82 ± 0.45 μm; the average EPZ015666 order concentration was 1.2 × 1010/ml; the average potential was -24.7 ± 0.56 mV (n = 4). Plasmid The pORF-HSVTK plasmid was carried out PCR amplification with upstream primer TKF(ACGCGTCGACATGGCCTCGTACCCCGGCCATCAACAC) and downstream primer TKR (CGCGGATCCTCAGTTAGCCTCCCCCATCTCCCGGG) to obtain about 1.2 kb target HSV-TK fragment. Then directionally connect HSV-TK target gene fragment and pIRES2-EGFP (Invitrogen, USA) vect with the help of DNA ligase to obtain recombinant plasmid pIRES2-EGFP-TK. The recombinant plasmid was transformed into DH5a Escherichia coli competent cells and spread on onkanamycin resistant LA plate for culture

of 12-16 h. When the colonies grew out, we selected positive clones to extract plasmid, followed by Sal I and BamH I enzymes cut identification and sequencing Elafibranor concentration by TaKaRa Company. Connection of microbubbles with plasmid According to the method of preparation of gene-loaded lipid microbubbles from the reference of Zhaoxia Wang [19]. We mixed the Ivacaftor research buy prepared

blank lipid microbubbles and poly-L-lysine (1 mg/ml) (Sigma Corporation, USA), and cultured at 37°C; for 30 min. Subnatant was soaked and deserted and washed twice by PBS. Naked plasmid (1 mg/ml) was added and incubated at 37°C; for 30 min, and washed by PBS twice. The manipulation was repeated three times. then gene-loaded lipid microbubbles were made. It was measured the average diameter of the HSV-TK wrapped microbubbles was between 2 μm to 4 μm and the concentration was 6.9 × 109/ml. The potential was -3.7 ± 0.56 mv (n = 4) and the plasmid concentration was 0.1 μg/μl. Animal model The study protocol was approved by the Animal Research Committee of our institution.40 Kunming mice, cleaning grade, body weight (20 ± 2 g), male, 6 to 8 weeks old, Loperamide were purchased from the Laboratory Animal Center of Third Military Medical University. H22 tumor cells (from Institute of ultrasonography, the second affiliated Hospital of Chongqing Medical University as a gift) were cultured in the RPMI 1640 medium (Hyclone, China) containing 10% betal bovine serum (FBS) at 37°C; with 5% CO2. We used serum-free RPMI1640 medium to adjust cell concentration to about 1 × 107/ml, followed by placenta blue exclusion dye test. The detected cell activity was >90%. Each mouse was inoculated 0.2 ml cell suspension subcutaneously in the right flank of Kunming mice. The tumor diameter was 0.5-1.