10 0.05 0.83 0.06 Push-up RPE Linear 1 0.13 0.06 0.81 0.06 Sprint RPE Linear 1 0.30 0.20 0.66 0.07 Error (Time) Avg RPE Linear 1 1.63 1.86 0.19 0.25 Error (Time) Agility RPE Linear 14 2.00       Push-up RPE Linear 14 2.23       Sprint RPE Linear 14 1.50         Average RPE Linear 14 0.88       aComputed using alpha = 0.05. bGeisser/Greenhouse correction. cScale of 6–20.

Lastly, a repeated-measures multivariate analysis (RM-MANOVA) was used to simultaneously test each treatment’s interaction effect on the performance tests. The RM-MANOVA yielded a significant MK-1775 price interaction effect for the three performance variables (p < 0.01). Therefore, the null hypothesis that there is no significant difference Selleckchem Saracatinib on performance when comparing the effects of VPX versus iCHO on performance following HIRT can be rejected. There was a significant interaction effect between the agility T-test, push-up, and sprint tests indicating the performance effect of VPX on the three performance

tests—when considered collectively—was greater than iCHO. Table  8 reports the RM-MANOVA results. A RM-MANOVA for RPE was not analyzed because the interaction effect for the average RPE for each treatment was sufficiently assessed in the univariate analysis. Table 8 Results of the RM-MANOVA of within-subjects contrasts for performance tests Effect Value F a p-value Observed powerb Within subjects Time Wilks’ Lambda 0.30 9.17 0.002 0.97 Discussion The purpose of this study was to examine the differential effects of a complex protein beverage Liothyronine Sodium and an isocaloric CHO beverage on performance measures and RPE following high-intensity

resistance training. High-intensity exercise—especially high-intensity resistance training—can significantly deplete muscle glycogen. Towards the end of the 15–18 minute 2:1 work to rest HIRT workout all subjects were experiencing cardiovascular and muscular fatigue. This HIRT workout was an original protocol developed by the primary researcher. However, it was inspired by previous studies that measured performance and/ or recovery following ingestion or supplementation of treatments such as Smith et al. [26] who utilized a 15–18 minute high-intensity cycling protocol to glycogen dilute the legs. The current design required subjects to whole-body glycogen dilute by executing compound, total body resistance and body weight exercises in a continuous, explosive pattern for two minutes. Most subjects could not reach 18 minutes (most stopped at 15 minutes) due to exhaustion; thus, implying the protocol was physically taxing and adequate to glycogen-deplete the muscles and instigate catabolic processes. In addition, the mechanical stress associated with resistance training places eccentric loading forces on the muscle fibers during muscle contraction, which micro-tears the muscle, and this catabolic environment hosts the mechanisms that affect MPS [12, 27].

coli (Fig. 6D). We confirmed the processing through the analysis of the ~28-kDa subunit by peptide mass fingerprinting. This peptide was identified as the C-terminal part of the IAL, evidencing Raf inhibitor that the IAL protein, like the IAT, also undergoes a phenomenon of self-processing. Figure 6 Characterization of the recombinant IAL in E. coli. (A) Agarose gel electrophoresis of the cDNA of the ial gene obtained by RT-PCR (RT). The 1-kb Ladder plus molecular marker (Invitrogen) is indicated as M. (B) Schematic representation of plasmid pULCT-ial. (C) SDS-PAGE showing

the overexpression of the ial gene in E. coli at 37°C. M: molecular mass marker; -I: uninduced cells; 37°C: total cell extracts obtained after a 5h-induction with IPTG at 37°C; I.B.: inclussion bodies obtained after a 5h-induction with IPTG at 37°C. (D) SDS-PAGE showing the overexpression of the ial gene in E. coli at 26°C. M: molecular mass marker; -I: uninduced

cells; 26°C: soluble cell extracts obtained after a 5h-induction with IPTG at 26°C. Note the lack of the 40-kDa band and the presence of the 28-kDa band. (E) Biossay carried out to determine the in vitro phenylacetyl-CoA: Selleckchem C59 wnt 6-APA acyltransferase activity (see Methods) present in the soluble extracts of E. coli overexpressing either the ial (IAL) or the penDE (IAT) genes. As a negative control, the reaction mixture was used without the addition of soluble extracts from E. coli overexpressing the penDE gene (C-). Once processing was confirmed, in vitro activity of the processed IAL protein was assessed (see Methods) using the soluble extracts of E. coli obtained after the overexpression of the ial gene at 26°C. As positive control, soluble extracts containing the functional processed IAT, obtained from E. out coli after overepression of the cDNA of

the wild-type penDE gene at 26°C (using plasmid pPBCαβ as indicated in Methods), were used. Benzylpenicillin formation was tested by bioassay as indicated in Methods. As shown in Fig. 6E, benzylpenicillin was only synthesized in the protein extracts containing the processed wild-type IAT, but not in extract of the processed IAL. This confirms that under in vitro conditions, the IAL protein also lacks enzymatic activities related to the biosynthesis of benzylpenicillin, despite the correct self-processing. Discussion The penicillin biosynthetic pathway has been largely elucidated [14, 32]. In addition to the three main enzymes involved in this process (ACVS, IPNS and IAT), other ancillary proteins are also required, such as a phenylacetyl-CoA ligases, which primes (activates) the aromatic side chain [4, 5] and the phosphopantetheinyl transferase (PPTase), which activates the ACVS and is essential for penicillin biosyntheis in P. chrysogenum [33]. The origin of the pen gene cluster is intriguing, as occurs with the clusters of other fungal secondary metabolites [12, 34].

Four different intimin types were identified: θ2 (theta), σ (sigma), τ (tau) and upsilon (Table 1). We have detected in aEPEC strains 4281-7 and 1632-7 (serotypes O104:H- and O26:H-, respectively)

two new intimin genes eae-τ and eae-ν that showed less than 95% nucleotide sequence identity with existing intimin genes. Furthermore, a third new variant of the eae gene (theta 2 – θ2) was identified Compound Library supplier in the aEPEC strain 1871-1 (serotype O34:H-). The complete nucleotide sequences of the new eae-θ2 (FM872418), eae-τ (tau) (FM872416) and eae-upsilon; (FM872417) variant genes were determined. By using CLUSTAL W [41] for optimal sequence alignment, we determined the genetic relationship of the three new intimin genes and the remaining 27 eae variants. A genetic identity of 90% was calculated between the new eae-τ (tau) variant and eae-γ2 (gama2),

eae-θ (theta) and eae-σ (sigma) genes. The eae-upsilon; showed a 94% of identity with eae-ι1. The eae-θ2 (theta-2) gene is very similar (99%) to eae-θ of Tarr & Whittam [20] and to eae-γ2 of Oswald et al. [19]. Table 1 Characteristics of the aEPEC strains studied. Strain Serotype Intimin Type Adherence pattern FAS test         HeLa cells T84 cells 0621-6 ONT:H- σ * LA + + 1551-2 ONT:H- ο LA + + 1632-7 O26:H- upsilon; ** DA + + 1871-1 O34:H- θ2 ** LAL + + 4051-6 O104:H2 ο AA + + 4281-7 O104:H-

τ** LAL + + E2348/69 O127:H6 α1 LA + Roxadustat ic50 + Adhesion pattern detected on HeLa cells: localized adherence (LA), localized adherence like (LAL), aggregative adherence (AA) and diffuse adherence (DA) (Vieira et al., 2001). (*) Strains that had eae gene sequenced in this study and (**) strains that carry new intimin subtypes (GenBank accession numbers: 1871-1 (FM872418); 4281-7 (FM872416) and 1632-7 (FM872417). Quantitative assessment of bacterial invasion Methisazone was performed with all strains, but different incubation-periods were used to test aEPEC strains (6 h) and tEPEC E2348/69 (3 h), because the latter colonizes more efficiently (establishes the LA pattern in 3 h) than aEPEC strains [3] and induce cell-detachment after 6 h of incubation (not shown). The quantitative gentamicin protection assay confirmed the invasive ability of aEPEC 1551-2 in HeLa cells and showed that 4 of the other 5 aEPEC strains studied were also significantly more invasive than tEPEC E2348/69 (Fig. 1A). The percentages of invasion found varied between 13.3% (SE ± 3.0) and 20.9% (SE ± 2.4), respectively, for aEPEC strains 4051-6 (intimin omicron) and 0621-6 (intimin sigma). When compared to tEPEC E2348/69 (intimin alpha 1) (1.4% ± 0.3), the invasion indexes of all strains were significantly higher (p < 0.05), except for aEPEC strain 4281-7 (intimin tau, 2.4% ± 0.3).

The amplification reactions were performed in 20 μl using 2 μl DNA extract (approximately 20 ng

of DNA) as a template. Real-time PCR reactions were performed in a LightCycler® 480 System using LightCycler® 480 SYBR Green I Master (Roche Diagnostics GmbH, Germany) according to recommendations given by the manufacturer of Lorlatinib the kit. The temperature program was as follows: 5 min initial denaturation at 95°C followed by 35 cycles of denaturation at 95°C for 10 s, annealing at 56°C for 10 s and primer extension at 72°C for 30 s. The amplifications were terminated after a final elongation step of 7 min at 72°C. The PCR fragments were verified by electrophoresis using Bioanalyzer (Agilent Technologies, USA). PCR products were purified and sequenced by Eurofins MWG Operon

(Ebersberg, Germany) using the dideoxy chain termination method on a ABI 3730XL sequencing instrument (Applied Biosystems, FK228 USA). Data analysis The Staden Package [44] was used for alignment, editation and construction of consensus sequences based on the ABI sequence chromatograms. Consensus sequences were entered into the MEGA4 [45] software and aligned by CLUSTALW [46]. Sequences were trimmed to be in frame and encode an exact number of amino acids. Dendograms for each locus (Additional Anacetrapib file 1) were constructed in MEGA4 using

the Neighbor-Joining method (NJ) with branch lengths estimated by the Maximum Composite Likelihood method [45, 47]. Branch quality was assessed by the bootstrap test using 500 replicates. A subset of six loci including adk, ccpA, recF, sucC, rpoB and spo0A, which gave the highest tree resolution and still being congruent (visual evaluation, Additional file 1), was selected for the final MLST scheme (highlighted in Table  1). The trimmed sequences were entered into BioNumerics software v. 6.6, (Applied Maths NV) as fasta files and used to generate allelic profiles for each isolate based on the six loci. Each unique allelic profile defined a sequence type (ST). A cluster analysis was performed using the allelic profiles as categorical coefficients and a dendogram was constructed based on the UPGMA method.

PubMedCrossRef

31. Dias RC, Marangoni DV, Riley LW, Moreira BM: Identification of uropathogenic Pirfenidone research buy Escherichia coli clonal group A (CgA) in hospitalised patients. Memorias do Instituto Oswaldo Cruz 2009,104(5):787–789.PubMedCrossRef 32. Johnson JR, Murray AC, Kuskowski MA, Schubert S, Prere MF, Picard B, Colodner R, Raz R: Distribution and characteristics of Escherichia coli clonal group A. Emerg Infect Dis 2005,11(1):141–145.PubMedCrossRef 33. Manges AR, Johnson JR, Foxman B, O’Bryan TT, Fullerton KE, Riley LW: Widespread distribution of urinary tract infections caused by a multidrug-resistant Escherichia coli clonal group. N Eng J Med 2001,345(14):1007–1013.CrossRef 34. Prats G, Navarro F, Mirelis B, Dalmau D, Margall N, Coll P, Stell A, Johnson JR: Everolimus Escherichia coli serotype O15:K52:H1 as a uropathogenic clone. J Clin Microbiol 2000,38(1):201–209.PubMed 35. Mihaila L, Wyplosz B, Clermont O, Garry L, Hipeaux MC, Vittecoq D, Dussaix E, Denamur E, Branger C: Probable intrafamily transmission of a highly virulent CTX-M-3-producing Escherichia coli belonging to the emerging phylogenetic subgroup D2 O102-ST405 clone. J Antimicrob Chemother 2010,65(7):1537–1539.PubMedCrossRef

36. Clermont O, Lavollay M, Vimont S, Deschamps C, Forestier C, Branger C, Denamur E, Arlet G: The CTX-M-15-producing Escherichia coli diffusing clone belongs to a highly virulent B2 phylogenetic subgroup. J Antimicrob Chemother 2008,61(5):1024–1028.PubMedCrossRef Competing interests The authors declare that they have no competing interests. Authors’ contribution AN was responsible for study conception Pregnenolone and design, data acquisition and analysis and drafted the manuscript. LP participated in the conception and design, analysis of data and preparation of the manuscript. CV, JP and CM contributed with data acquisition and analysis. TC and GD were implicated in data analysis and preparation of the manuscript. All authors read and approved the final manuscript.”
“Background Chlamydia

trachomatis is a Gram-negative obligate intracellular bacterium that is a leading cause of preventable blindness and sexually transmitted diseases worldwide [1]. Much of the biology of infection and disease remains unclear in this system, owing largely to the lack of a routine genetic system for these organisms. While many aspects of these challenges have recently been overcome [2, 3], the use of genetic transformation in this system is just beginning to be exploited. One aspect of chlamydial biology that is poorly understood involves the mechanism of lateral gene transfer among chlamydial strains both in the laboratory and, most likely, in patients. Coinfection of host cells in vitro with chlamydial isolates encoding different drug resistance markers lead to generation of dual resistant recombinant progeny [4, 5].

Unlike to the MDSC from 4T1 tumor bearing mice, the expression of T cell mediates suppression; INOS2 and Arginase1 by Inf-MDSC are not dependent on IFNg. Inf-MDSC are able to suppress check details NK cell activity in vivo via reduction of the NK activating receptor NKG2D. In vitro this suppressive activity is dependent on

cell-to-cell contact. The inflammatory signal (IL-1b) up-regulates IL-4Ra expression of MDSC, which correlates with enhanced tumor growth and suppression of cytotoxic activity of NK cell. Our data suggest that tumor derived inflammation enhances the development of a specific MDSC subset that has the ability to suppress T and NK cells, and therefore, can serve as a new target for chemotherapy. O106 Triggering of TLR7 and 8 on Human Lung Cancer Induces Cell Survival and Chemoresistance Julien Cherfils-Vicini1, Sophia Platonova1, Pierre Validire1, Fathia Mami-Chouaib2, Marie-Caroline Dieu-Nosjean1, Wolf Herman Fridman1, Christos Chouaid3, Diane Damotte1, Catherine Sautès-Fridman1, Isabelle Cremer 1 1 Team 13: Immune microenvironment and tumors, U872 INSERM, Paris, France, 2 Institut Gustave Roussy, U753 INSERM, Villejuif, France, 3 Service de pneumologie, AP-HP Hôpital

St Antoine, Paris, France Lung tumor prognosis is very bad, with a survival rate being 20 to 30% five years after surgery. In general, patients relapse AZD1208 price into three years because they develop metastasis. It is thus crucial to identify novel therapies or combinatory therapies to improve the prognosis of the disease. To date, the proposed therapies for NSCLC patients consists Chlormezanone in surgery associated with neo-adjuvant or adjuvant polychemotherapy. Novel cancer immunotherapies using TLR7 or 8 agonists are being developed, which are based on the amplification of immune responses. However, recent studies implicate some TLRs in tumor development based on their ability to facilitate tumor growth, but TLR7 and 8

have not yet been implicated. We hypothesized that TLR7 and 8 are expressed by lung tumor cells, and their signaling could interfere with chemotherapy-induced cell death. We demonstrate for the first time that TLR7 and TLR8 are highly expressed by primary human lung tumor cells in NSCLC. We show TLR7 ligation with Loxoribine or TLR8 ligation with Poly U results in activation of NF-kB and upregulation of Bcl-2 expression. This is associated with increased tumor cell survival and a strong resistance to apoptosis induced by chemotherapeutic agents that are currently used to treat patients. Finally, transcriptional analysis revealed a gene expression signature that suggests chronic stimulation of tumor cells by TLR7 and 8 ligands in situ. TLR7 or 8 expression by lung tumor cells in patients could predict bad responders to standard chemotherapies and could allow to adapt the new therapeutic protocols. We propose that anticancer immunotherapies using TLR7 or 8 adjuvants should take into account the expression of these TLRs on tumor cells.

However, conspicuous

variations in sensitivity and specificity of invA-based PCR assays have been documented by numerous studies [1, 29–35], and one of the possible reasons for such discordant outcomes may be due to the use of different primers for gene detection in the assays such as conventional or qPCR [36]. In an effort to better understand the variations caused by the usage of different primers for gene detection in PCR assays, we systematically evaluated selleck chemical the most commonly used invA primer pairs for the detection of Salmonella in thirteen (n = 13) PCR assays (Table 3; Figure 4). First, although the invA-based PCR assays generate reasonably good results for Salmonella detection, in some cases, the false-negative and false-positive rates were rather high [29]. The reasons

for these false-negative and false-positive results are not clear, but primers and probes used for gene detection may be to blame. Although the invA gene is encoded by almost all strains in Salmonella spp. examined, our BLAST sequence analysis revealed that the invA gene sequence is rather heterogenic among the Salmonella group of more than 2600 serotypes, especially at the 5-′ and 3′- ends of the gene. Furthermore, regions further into the gene, single nucleotide polymorphisms (SNPs) occur sporadically at different locations with variable frequencies see more among Salmonella spp. Inevitably, it becomes a formidable task to detect such a broad and diversified Salmonella group by targeting a single gene. If previously designed primer pairs listed in Table 3 are used, several PCR assays would fail to detect

numerous Salmonella spp., whose sequences are currently available in GenBank. This could partially explain the false-negative results encountered in Salmonella detection [36]. At the same time, although invA is capable of excluding non-Salmonella strains, our BLAST sequence analysis of invA demonstrated that some non-Salmonella groups such as E. coli, Staphylococcus aureus subsp. aureus, and Solanum lycopersicoides shared identities with Salmonella invA. This could give a possible explanation for the false-positive results reported by some analysis [36]. Table 3 PCR primer pairs used for targeting invA gene for detection of Salmonella Primer sequence (5′—3′) Type of PCR Position Length (bp) most Reference (year) GCTGCGCGCGAACGGCGAAG Conventional 586-608 389 Ferretti et al. (2001) TCCCGGCAGAGTTCCCAT T   972-954     ACAGTGCTCGTTTACGACCT AAT Conventional 104-127 244 Chiu and Ou (1996) AGACGACTGGTACTGATCGATAAT   347-324     GTGAAATAATCGCCACGTTCGGGCAA Conventional 371-396 285 Malorny and Hoorfar (2005) TCATCGCACCGTCAAAGGAACC   655-634     GTGAAATAATCGCCACGTTCGGGCAA Conventional 371-396 285 Rahn et al. (1992) [28] TCATCGCACCGTCAAAGGAACC6   655-634     AGTGCTCGTTTACGACCTGAA Conventional 106-126 229 Mainar-Jaime et. al. ( 2013) [29] TGATCGATAATGCCAGACGA   334-315     ACAGTGCTCGTTTACGACC Conventional 104-122 1614 Banihashemi et al.

Moreover, 7 of 22 samples where the MR allele was detected by sequencing were monoinfections (i.e. there were no two partners for template switching). This MR hybrid family was quite diverse as eight alleles were observed. Allele DMR1 had a group1 type Mad20 while alleles DMR 2-8 derived from Mad20 group 2. All DMR Decitabine cell line alleles carried the same 25-residue long, RO33-type downstream region, which interestingly was a RD5 allelic type

with a G97D D104N double mutation (Table 2). A novel hybrid, DMRK, displayed a RO33-K1 hybrid sequence in the family-specific 3′ region (the K1 sequence located in 3′ is underlined in Table 2) [for further analysis see Additional BVD-523 file 4]. The large local diversity was associated with a large number of low frequency alleles in the K1 and Mad20/MR family

types, contrasting with the RO33 family where a dominant RD0 allele was observed in 78% (97 of 124) of the sequenced RO33-types alleles (Figure 5A). At the population level (Figure 5B), RD0 was by far the most frequent allele, accounting for 27% of the sequenced samples (top pie chart) and 19.7% of all alleles within the village when adjusted for relative family frequency estimated by nested PCR genotyping (bottom pie chart). The second most frequent allele after adjusting for family frequency was DK65 (adjusted frequency: 4.6%). Most alleles (107 of 126) presented Exoribonuclease a less than 1% frequency in the population sample studied here. In terms of frequency, the largest contribution among the top 19 alleles came from the RO33 family. Figure 5 Distribution of Pfmsp1 block2 allele frequency in Dielmo. A. Distribution by family based on sequenced alleles: K1-types (N sequenced = 144), Mad20-types grouped together with hybrid types (N sequenced = 90) and RO33-types

(N sequenced = 124). Each family is depicted separately, with alleles ranked clockwise by allele number coded as shown in Table 2. B. Relative individual allele frequency in the 358 sequenced fragments (top) and adjusted to the overall population based on relative family distribution established by nested PCR on 524 PCR fragments (bottom). Identical colour codes used for A and B, ordered clockwise as follows: RD types (light blue colours), Hybrids (green and orange), DM (orange-yellow) and DK alleles (indigo-dark blue colours), with alleles ranked clockwise by allele number coded as shown in Table 2.

It can also provide information on the taxonomic assignments of specific T-RFs without the need for comprehensive complementary Sunitinib nmr clone libraries. Availability and requirements Project name: T-RFPred Project home page: http://​nodens.​ceab.​csic.​es/​t-rfpred/​ Operating

systems: Linux (tested in Debian, Ubuntu and RHEL), Mac OS X (tested in MacOS X 10.5 and Mac OS X 10.6), Windows (via a Xubuntu VMware image) Programming language: Perl Other requirements: BioPerl, BLAST and EMBOSS License: none Any restrictions to use by non-academics: none Acknowledgements This work was supported by grant PIRENA CGL2009-13318-CO2-01/BOS to EOC, grant CTM2007-63753-C02-01/MAR to JMG, and grant CONSOLIDER-INGENIO2010 GRACCIE CSD2007-00067 to AFG from the Spanish Ministry of Science and Innovation, and grant OCE-0550485 from the National Science Foundation to AB. Electronic supplementary material Additional file 1: “”Project website”", “”Additional Experimental Procedure”" and “”Supplementary Tables

S1-S3″”. Project website. Webpage to download T-RFPred. Additional Experimental Procedure. Origin of chromatograms and reference datasets to label the peaks on Figure 2. Supplementary Tables S1-S3. Typical output of T-RFPred for the clone sequences from [4–6], respectively. (PDF 86 KB) References 1. Liu Sorafenib concentration W-T, Marsh TL, Cheng H, Forney LJ: Characterization of microbial diversity by Interleukin-3 receptor determining terminal restriction fragment length polymorphisms of genes encoding 16S rRNA. Appl Environ Microbiol 1997, 63:4516–4522.PubMed 2. Marsh TL: Terminal restriction fragment length polymorphism (T-RFLP): an emerging method for characterizing diversity among homologous populations of amplification products. Curr Opin Microbiol 1999, 2:323–327.PubMedCrossRef 3. Blackwood CB,

Marsh T, Kim S-H, Paul EA: Terminal restriction fragment length polymorphism data analysis for quantitative comparison of microbial communities. Appl Environ Microbiol 2003, 69:926–932.PubMedCrossRef 4. González JM, Simó R, Massana R, Covert JS, Casamayor EO, Pedrós-Alió C, Moran MA: Bacterial community structure associated with a dimethylsulfoniopropionate-producing North Atlantic algal bloom. Appl Environ Microbiol 2000, 66:4237–4246.PubMedCrossRef 5. Mou X, Moran MA, Stepanauskas R, González JM, Hodson RE: Flow-cytometric cell sorting and subsequent molecular analyses for culture-independent identification of bacterioplankton involved in dimethylsulfoniopropionate transformations. Appl Environ Microbiol 2005, 71:1405–1416.PubMedCrossRef 6. Pinhassi J, Simó R, González JM, Vila M, Alonso-Sáez L, Kiene RP, Moran MA, Pedrós-Alió C: Dimethylsulfoniopropionate turnover is linked to the composition and dynamics of the bacterioplankton assemblage during a microcosm phytoplankton bloom. Appl Environ Microbiol 2005, 71:7650–7660.PubMedCrossRef 7.

Lancet 1998,351(9097):213–214.CrossRefPubMed 17. Sorvillo F, Kovacs A, Kerndt P, Stek A, Muderspach L, Sanchez-Keeland L: Risk factors for Dinaciclib nmr trichomoniasis among women with human immunodeficiency virus (HIV) infection at a public clinic in Los Angeles County, California: implications for HIV prevention. Am J Trop Med Hyg 1998,58(4):495–500.PubMed 18. Hersh SM: Pulmonary trichomoniasis and Trichomonas tenax. J Med Microbiol 1985,20(1):1–10.CrossRefPubMed 19. Chiche L, Donati S, Corno G, Benoit S, Granier I, Chouraki M, Arnal JM, Durand-Gasselin J: [ Trichomonas tenax in pulmonary and pleural diseases]. Presse Med 2005,34(19 Pt 1):1371–1372.CrossRefPubMed 20. El Kamel A, Rouetbi N, Chakroun M, Battikh M: Pulmonary

eosinophilia due to Trichomonas tenax. Thorax 1996,51(5):554–555.CrossRefPubMed 21. Mahmoud MS, Rahman GA: Pulmonary trichomoniasis: improved diagnosis by using polymerase chain reaction targeting Trichomonas tenax 18S rRNA gene in sputum specimens. J Egypt Soc Parasitol 2004,34(1):197–211.PubMed 22. Mallat H, Podglajen I, Lavarde V, Mainardi JL, Frappier J, Cornet M: Molecular characterization of Trichomonas tenax causing pulmonary infection. J Clin Microbiol 2004,42(8):3886–3887.CrossRefPubMed 23. Porcheret H, Maisonneuve L, Esteve V, Jagot JL, Le Pennec MP: [Pleural trichomoniasis due to Trichomonas tenax]. Rev Mal Respir 2002,19(1):97–99.PubMed 24. Duboucher C, Caby S, Chabe M, Gantois N, Delgado-Viscogliosi

P, Pierce R, Capron M, Dei-Cas E, Viscogliosi E: [Human pulmonary trichomonoses].

Presse Med 2007,36(5 learn more Pt 2):835–839.CrossRefPubMed 25. Gerbod D, Sanders E, Moriya S, Noel C, Takasu H, Fast NM, Delgado-Viscogliosi P, Ohkuma M, Kudo T, Capron M, Palmer JD, Viscogliosi Adenosine triphosphate E: Molecular phylogenies of Parabasalia inferred from four protein genes and comparison with rRNA trees. Mol Phylogenet Evol 2004,31(2):572–580.CrossRefPubMed 26. Gerbod D, Edgcomb VP, Noel C, Vanacova S, Wintjens R, Tachezy J, Sogin ML, Viscogliosi E: Phylogenetic relationships of class II fumarase genes from trichomonad species. Mol Biol Evol 2001,18(8):1574–1584.PubMed 27. Kucknoor A, Mundodi V, Alderete JF:Trichomonas vaginalis adherence mediates differential gene expression in human vaginal epithelial cells. Cell Microbiol 2005,7(6):887–897.CrossRefPubMed 28. Arroyo R, Engbring J, Nguyen J, Musatovova O, Lopez O, Lauriano C, Alderete JF: Characterization of cDNAs encoding adhesin proteins involved in Trichomonas vaginalis cytoadherence. Arch Med Res 1995,26(4):361–369.PubMed 29. Kucknoor AS, Mundodi V, Alderete JF: The proteins secreted by Trichomonas vaginalis and vaginal epithelial cell response to secreted and episomally expressed AP65. Cell Microbiol 2007,9(11):2586–2597.CrossRefPubMed 30. Decarneri I, Giannone R: Frequency of Trichomonasvaginalis, Trichomonas tenax and Entamoeba gingivalis Infections and Absence of Correlation between Oral and Vaginal Protozooses in Italian Women.